Recombinant:Article Title: Molecular Mechanism Underlying Inhibition of Intrinsic ATPase Activity in a Ski2-like RNA Helicase.
Article Snippet: .. Sf9 cells were cultivated in Sf-900TM REAGENT or RESOURCE SOURCE IDENTIFIER Chemicals, Peptides, and Recombinant Proteins cBrr2T4 Absmeier et al., 2015b N/A ATPgS Jena Bioscience https://www.jenabioscience.com/ ADP Jena Bioscience https://www.jenabioscience.com/ Deposited Data Crystal structure of apo cBrr2T4 This paper PDB: 6QWS Crystal structure of cBrr2T4 ADP This paper PDB: 6QV3 Crystal structure of cBrr2T4 ATPyS This paper PDB: 6QV4 Crystal structure of cBrr2T3-cJab1 Absmeier et al., 2017 PDB: 5M59 Crystal structure of cPrp43-ADP$BeF3 Tauchert et al., 2017 PDB: 5LTJ Crystal structure of cPrp43-ADP$BeF3/U7 RNA oligo Tauchert et al., 2017 PDB: 5LTA Crystal structure of cPrp43-ADP Tauchert et al., 2017 PDB: 5D0U CryoEM structure of yU4/U6$U5 tri-snRNP Nguyen et al., 2016 PDB: 5GAN Recombinant DNA Plasmid: cBrr2T4 in pFLHis Absmeier et al., 2015b N/A Oligonucleotides Saccharomyces cerevisiae U6 DNA template for in vitro transcription: GTTCGCGAAGTAACCCTTCGTGGACATTTGG TCAATTTGAAACAATACAGAGATGATCAGCAG TTCCCCTGCATAAGGATGAACCGTTTTAC AAAGAGATTTATTTCGTTTT Santos et al., 2012 N/A Saccharomyces cerevisiae U4 DNA template for in vitro transcription: ATCCTTATGCACGGGAAATACGCATATCAGTG AGGATTCGTCCGAGATTGTGTTTTTGCTGGTTG AAATTTAATTATAAACCAGACCGTCTCCTCATG GTCAATTCGGTGTTCGCTTTTGAATACTTCAAG ACTATGTAGGGAATTTTTGGAATACCTTT Santos et al., 2012 N/A Software and Algorithms Coot Emsley et al., 2010 http://www.ccp4.ac.uk/ phenix Afonine et al., 2012 https://www.phenix-online.org/ CCP4 Winn et al., 2011 https://www.ccp4.ac.uk/ PyMOL Schrodinger, LLC https://pymol.org/ XDS Kabsch, 2010 http://xds.mpimf-heidelberg.mpg.de/ Structure 28, 1–8.e1–e3, February 4, 2020 e1 II SFM (Gibco) at 27 C in a 6 well plate for initial virus production and in shaking cultures at 27 C and 70 rpm for V1 production. .. High FiveTM insect cell (Thermo Fisher Scientific) were cultivated in Express Five SFM (Gibco), supplemented with L-glutamine, in shaking cultures at 27 C and 70 rpm.
Plasmid Preparation:Article Title: Molecular Mechanism Underlying Inhibition of Intrinsic ATPase Activity in a Ski2-like RNA Helicase.
Article Snippet: .. Sf9 cells were cultivated in Sf-900TM REAGENT or RESOURCE SOURCE IDENTIFIER Chemicals, Peptides, and Recombinant Proteins cBrr2T4 Absmeier et al., 2015b N/A ATPgS Jena Bioscience https://www.jenabioscience.com/ ADP Jena Bioscience https://www.jenabioscience.com/ Deposited Data Crystal structure of apo cBrr2T4 This paper PDB: 6QWS Crystal structure of cBrr2T4 ADP This paper PDB: 6QV3 Crystal structure of cBrr2T4 ATPyS This paper PDB: 6QV4 Crystal structure of cBrr2T3-cJab1 Absmeier et al., 2017 PDB: 5M59 Crystal structure of cPrp43-ADP$BeF3 Tauchert et al., 2017 PDB: 5LTJ Crystal structure of cPrp43-ADP$BeF3/U7 RNA oligo Tauchert et al., 2017 PDB: 5LTA Crystal structure of cPrp43-ADP Tauchert et al., 2017 PDB: 5D0U CryoEM structure of yU4/U6$U5 tri-snRNP Nguyen et al., 2016 PDB: 5GAN Recombinant DNA Plasmid: cBrr2T4 in pFLHis Absmeier et al., 2015b N/A Oligonucleotides Saccharomyces cerevisiae U6 DNA template for in vitro transcription: GTTCGCGAAGTAACCCTTCGTGGACATTTGG TCAATTTGAAACAATACAGAGATGATCAGCAG TTCCCCTGCATAAGGATGAACCGTTTTAC AAAGAGATTTATTTCGTTTT Santos et al., 2012 N/A Saccharomyces cerevisiae U4 DNA template for in vitro transcription: ATCCTTATGCACGGGAAATACGCATATCAGTG AGGATTCGTCCGAGATTGTGTTTTTGCTGGTTG AAATTTAATTATAAACCAGACCGTCTCCTCATG GTCAATTCGGTGTTCGCTTTTGAATACTTCAAG ACTATGTAGGGAATTTTTGGAATACCTTT Santos et al., 2012 N/A Software and Algorithms Coot Emsley et al., 2010 http://www.ccp4.ac.uk/ phenix Afonine et al., 2012 https://www.phenix-online.org/ CCP4 Winn et al., 2011 https://www.ccp4.ac.uk/ PyMOL Schrodinger, LLC https://pymol.org/ XDS Kabsch, 2010 http://xds.mpimf-heidelberg.mpg.de/ Structure 28, 1–8.e1–e3, February 4, 2020 e1 II SFM (Gibco) at 27 C in a 6 well plate for initial virus production and in shaking cultures at 27 C and 70 rpm for V1 production. .. High FiveTM insect cell (Thermo Fisher Scientific) were cultivated in Express Five SFM (Gibco), supplemented with L-glutamine, in shaking cultures at 27 C and 70 rpm.
In Vitro:Article Title: Molecular Mechanism Underlying Inhibition of Intrinsic ATPase Activity in a Ski2-like RNA Helicase.
Article Snippet: .. Sf9 cells were cultivated in Sf-900TM REAGENT or RESOURCE SOURCE IDENTIFIER Chemicals, Peptides, and Recombinant Proteins cBrr2T4 Absmeier et al., 2015b N/A ATPgS Jena Bioscience https://www.jenabioscience.com/ ADP Jena Bioscience https://www.jenabioscience.com/ Deposited Data Crystal structure of apo cBrr2T4 This paper PDB: 6QWS Crystal structure of cBrr2T4 ADP This paper PDB: 6QV3 Crystal structure of cBrr2T4 ATPyS This paper PDB: 6QV4 Crystal structure of cBrr2T3-cJab1 Absmeier et al., 2017 PDB: 5M59 Crystal structure of cPrp43-ADP$BeF3 Tauchert et al., 2017 PDB: 5LTJ Crystal structure of cPrp43-ADP$BeF3/U7 RNA oligo Tauchert et al., 2017 PDB: 5LTA Crystal structure of cPrp43-ADP Tauchert et al., 2017 PDB: 5D0U CryoEM structure of yU4/U6$U5 tri-snRNP Nguyen et al., 2016 PDB: 5GAN Recombinant DNA Plasmid: cBrr2T4 in pFLHis Absmeier et al., 2015b N/A Oligonucleotides Saccharomyces cerevisiae U6 DNA template for in vitro transcription: GTTCGCGAAGTAACCCTTCGTGGACATTTGG TCAATTTGAAACAATACAGAGATGATCAGCAG TTCCCCTGCATAAGGATGAACCGTTTTAC AAAGAGATTTATTTCGTTTT Santos et al., 2012 N/A Saccharomyces cerevisiae U4 DNA template for in vitro transcription: ATCCTTATGCACGGGAAATACGCATATCAGTG AGGATTCGTCCGAGATTGTGTTTTTGCTGGTTG AAATTTAATTATAAACCAGACCGTCTCCTCATG GTCAATTCGGTGTTCGCTTTTGAATACTTCAAG ACTATGTAGGGAATTTTTGGAATACCTTT Santos et al., 2012 N/A Software and Algorithms Coot Emsley et al., 2010 http://www.ccp4.ac.uk/ phenix Afonine et al., 2012 https://www.phenix-online.org/ CCP4 Winn et al., 2011 https://www.ccp4.ac.uk/ PyMOL Schrodinger, LLC https://pymol.org/ XDS Kabsch, 2010 http://xds.mpimf-heidelberg.mpg.de/ Structure 28, 1–8.e1–e3, February 4, 2020 e1 II SFM (Gibco) at 27 C in a 6 well plate for initial virus production and in shaking cultures at 27 C and 70 rpm for V1 production. .. High FiveTM insect cell (Thermo Fisher Scientific) were cultivated in Express Five SFM (Gibco), supplemented with L-glutamine, in shaking cultures at 27 C and 70 rpm.
Software:Article Title: Molecular Mechanism Underlying Inhibition of Intrinsic ATPase Activity in a Ski2-like RNA Helicase.
Article Snippet: .. Sf9 cells were cultivated in Sf-900TM REAGENT or RESOURCE SOURCE IDENTIFIER Chemicals, Peptides, and Recombinant Proteins cBrr2T4 Absmeier et al., 2015b N/A ATPgS Jena Bioscience https://www.jenabioscience.com/ ADP Jena Bioscience https://www.jenabioscience.com/ Deposited Data Crystal structure of apo cBrr2T4 This paper PDB: 6QWS Crystal structure of cBrr2T4 ADP This paper PDB: 6QV3 Crystal structure of cBrr2T4 ATPyS This paper PDB: 6QV4 Crystal structure of cBrr2T3-cJab1 Absmeier et al., 2017 PDB: 5M59 Crystal structure of cPrp43-ADP$BeF3 Tauchert et al., 2017 PDB: 5LTJ Crystal structure of cPrp43-ADP$BeF3/U7 RNA oligo Tauchert et al., 2017 PDB: 5LTA Crystal structure of cPrp43-ADP Tauchert et al., 2017 PDB: 5D0U CryoEM structure of yU4/U6$U5 tri-snRNP Nguyen et al., 2016 PDB: 5GAN Recombinant DNA Plasmid: cBrr2T4 in pFLHis Absmeier et al., 2015b N/A Oligonucleotides Saccharomyces cerevisiae U6 DNA template for in vitro transcription: GTTCGCGAAGTAACCCTTCGTGGACATTTGG TCAATTTGAAACAATACAGAGATGATCAGCAG TTCCCCTGCATAAGGATGAACCGTTTTAC AAAGAGATTTATTTCGTTTT Santos et al., 2012 N/A Saccharomyces cerevisiae U4 DNA template for in vitro transcription: ATCCTTATGCACGGGAAATACGCATATCAGTG AGGATTCGTCCGAGATTGTGTTTTTGCTGGTTG AAATTTAATTATAAACCAGACCGTCTCCTCATG GTCAATTCGGTGTTCGCTTTTGAATACTTCAAG ACTATGTAGGGAATTTTTGGAATACCTTT Santos et al., 2012 N/A Software and Algorithms Coot Emsley et al., 2010 http://www.ccp4.ac.uk/ phenix Afonine et al., 2012 https://www.phenix-online.org/ CCP4 Winn et al., 2011 https://www.ccp4.ac.uk/ PyMOL Schrodinger, LLC https://pymol.org/ XDS Kabsch, 2010 http://xds.mpimf-heidelberg.mpg.de/ Structure 28, 1–8.e1–e3, February 4, 2020 e1 II SFM (Gibco) at 27 C in a 6 well plate for initial virus production and in shaking cultures at 27 C and 70 rpm for V1 production. .. High FiveTM insect cell (Thermo Fisher Scientific) were cultivated in Express Five SFM (Gibco), supplemented with L-glutamine, in shaking cultures at 27 C and 70 rpm.
Virus:Article Title: Molecular Mechanism Underlying Inhibition of Intrinsic ATPase Activity in a Ski2-like RNA Helicase.
Article Snippet: .. Sf9 cells were cultivated in Sf-900TM REAGENT or RESOURCE SOURCE IDENTIFIER Chemicals, Peptides, and Recombinant Proteins cBrr2T4 Absmeier et al., 2015b N/A ATPgS Jena Bioscience https://www.jenabioscience.com/ ADP Jena Bioscience https://www.jenabioscience.com/ Deposited Data Crystal structure of apo cBrr2T4 This paper PDB: 6QWS Crystal structure of cBrr2T4 ADP This paper PDB: 6QV3 Crystal structure of cBrr2T4 ATPyS This paper PDB: 6QV4 Crystal structure of cBrr2T3-cJab1 Absmeier et al., 2017 PDB: 5M59 Crystal structure of cPrp43-ADP$BeF3 Tauchert et al., 2017 PDB: 5LTJ Crystal structure of cPrp43-ADP$BeF3/U7 RNA oligo Tauchert et al., 2017 PDB: 5LTA Crystal structure of cPrp43-ADP Tauchert et al., 2017 PDB: 5D0U CryoEM structure of yU4/U6$U5 tri-snRNP Nguyen et al., 2016 PDB: 5GAN Recombinant DNA Plasmid: cBrr2T4 in pFLHis Absmeier et al., 2015b N/A Oligonucleotides Saccharomyces cerevisiae U6 DNA template for in vitro transcription: GTTCGCGAAGTAACCCTTCGTGGACATTTGG TCAATTTGAAACAATACAGAGATGATCAGCAG TTCCCCTGCATAAGGATGAACCGTTTTAC AAAGAGATTTATTTCGTTTT Santos et al., 2012 N/A Saccharomyces cerevisiae U4 DNA template for in vitro transcription: ATCCTTATGCACGGGAAATACGCATATCAGTG AGGATTCGTCCGAGATTGTGTTTTTGCTGGTTG AAATTTAATTATAAACCAGACCGTCTCCTCATG GTCAATTCGGTGTTCGCTTTTGAATACTTCAAG ACTATGTAGGGAATTTTTGGAATACCTTT Santos et al., 2012 N/A Software and Algorithms Coot Emsley et al., 2010 http://www.ccp4.ac.uk/ phenix Afonine et al., 2012 https://www.phenix-online.org/ CCP4 Winn et al., 2011 https://www.ccp4.ac.uk/ PyMOL Schrodinger, LLC https://pymol.org/ XDS Kabsch, 2010 http://xds.mpimf-heidelberg.mpg.de/ Structure 28, 1–8.e1–e3, February 4, 2020 e1 II SFM (Gibco) at 27 C in a 6 well plate for initial virus production and in shaking cultures at 27 C and 70 rpm for V1 production. .. High FiveTM insect cell (Thermo Fisher Scientific) were cultivated in Express Five SFM (Gibco), supplemented with L-glutamine, in shaking cultures at 27 C and 70 rpm.
|
Jena Bioscience is a verified supplier 
Jena Bioscience manufactures this product 